Review



peroxidase standard vector laboratories pk 6100 fluorescence  (Vector Laboratories)


Bioz Verified Symbol Vector Laboratories is a verified supplier
Bioz Manufacturer Symbol Vector Laboratories manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Vector Laboratories peroxidase standard vector laboratories pk 6100 fluorescence
    Peroxidase Standard Vector Laboratories Pk 6100 Fluorescence, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 99/100, based on 12720 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peroxidase+standard+vector+laboratories+pk+6100+fluorescence/VECTASTAIN+Elite+ABC+HRP+Kit+(Peroxidase%2C+Standard)/pm39581554-92-85-87
    Average 99 stars, based on 12720 article reviews
    peroxidase standard vector laboratories pk 6100 fluorescence - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Immunohistochemistry:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..

    Western Blot:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..

    Fluorescence:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..

    Flow Cytometry:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..

    Staining:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..

    Ligation:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..

    Adjuvant:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..

    Sequencing:

    Article Title: The effect of a dominant kinase-dead Csf1r mutation associated with adult-onset leukoencephalopathy on brain development and neuropathology.
    Article Snippet: .. Antibodies Target Format Clone Supplier Catalogue Number Primary antibodies Rabbit anti-IBA1 IHC and IF Polyclonal FUJIFILM Wako 019–19,741 Rabbit anti-GFAP IHC Polyclonal Agilent Z0334 Mouse anti-β-actin (C4) WB Monoclonal Santa Cruz Biotechnology sc-47,778 Secondary antibodies Goat anti-rabbit IgG Biotinylated N/A Jackson Immunoresearch 111–005-144 Goat anti-mouse IgG Biotinylated N/A Jackson Immunoresearch 111–005-166 HRP-AffiniPure Goat Anti-mouse IgG HRP N/A Jackson Immunoresearch 115–035-166 Counterstain 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) IF N/A Sigma Aldrich D9542 IHC Reagents Reagent Supplier Catalogue Number Target antigen retrieval solution Dako S1699 VECTASTAIN® Elite® ABC Kit, Peroxidase (Standard) Vector Laboratories PK-6100 Fluorescence Mounting Medium Agilent S3023 Flow Cytometry Antibodies Target Fluorochrome Clone Supplier Catalogue Number Microglia Panel CD115 PE-Cy7 AFS98 Biolegend® 135,524 CD11b BV510 M1/70 Biolegend® 101,245 CD45 BV421 30-F11 Biolegend® 103,134 Viability dye 7-Aminoactinomycin D PerCP-Cy5.5 N/A Thermo ScientificTM A1310 (7AAD) Other Reagents Reagent Supplier Catalogue Number BM Chemiluminescent Western Blotting Substrate Kit Roche 11,500,694,001 OCT ProSciTech IA018 Luxol Fast Blue Stain Kit Abcam ab150675 TRI Reagent Sigma Aldrich T9424 UltraPureTM DNAse, RNAse free Distilled Water Life Technologies 10,977–015 DNase I treatment Roche 4,716,728,001 Illumina Stranded mRNA Library Prep Ligation kit Illumina 20,040,534 Tris-Glycine SDS sample buffer Life Technologies LC2676 NuPageTM 12 % Tris-glycine polyacrylamide gels Life Technologies WXP01212 Mycobacterium tuberculosis Invivogen tlrl-hkmt-1 Incomplete Freud’s adjuvant Merck F5506 Myelin oligodendrocyte glycoprotein (35–55) Mimetopes 51,716–001 Pertussis toxin Merck P7208 Primer Target Forward Primer Sequence Reverse Primer Sequence Aif1 GGATCAACAAGCAATTCCTCGA CTGAGAAAGTCAGAGTAGCTGA Csf1r AGGCAGGCTGGAATAATCTGACCT CGTCACAGAACAGGACATCAGAGC Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Il1b TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT Tmem119 GTGTCTAACAGGCCCCAGAA AGCCACGTGGTATCAAGGAG Il6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA P2ry12 GGGCGTACCCTACAGAAACA TGGGAGGGCCGATGTTATTG Itgam TGGCCTATACAAGCTTGGCTTT AAAGGCCGTTACTGAGGTGG Tnf TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA NovaSeq 6000 S1 reagent kit v1.5 (200 cycles) or an SP reagent kit v1.5 (200 cycles). ..



    Similar Products

    99
    Vector Laboratories peroxidase standard vector laboratories pk 6100 fluorescence
    Peroxidase Standard Vector Laboratories Pk 6100 Fluorescence, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peroxidase+standard+vector+laboratories+pk+6100+fluorescence/VECTASTAIN+Elite+ABC+HRP+Kit+(Peroxidase%2C+Standard)/pm39581554-92-85-87
    Average 99 stars, based on 1 article reviews
    peroxidase standard vector laboratories pk 6100 fluorescence - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results